Feedforward Coordinate Control of a Robotic Cell Injection Catheter.

Remote and robotically actuated catheters are the stepping-stones toward autonomous catheters, where complex intravascular procedures may be performed with minimal intervention from a physician. This article proposes a concept for the positional, feedforward control of a robotically actuated cell injection catheter used for the injection of myogenic or undifferentiated stem cells into the myocardial infarct boundary zones of the left ventricle. The prototype for the catheter system was built upon a needle-based catheter with a single degree of deflection, a 3-D printed handle combined with actuators, and the Arduino microcontroller platform. A bench setup was used to mimic a left ventricle catheter procedure starting from the femoral artery. Using Matlab and the open-source video modeling tool Tracker, the planar coordinates ( y, z) of the catheter position were analyzed, and a feedforward control system was developed based on empirical models. Using the Student's t test with a sample size of 26, it was determined that for both the y- and z-axes, the mean discrepancy between the calibrated and theoretical coordinate values had no significant difference compared to the hypothetical value of µ = 0. The root mean square error of the calibrated coordinates also showed an 88% improvement in the z-axis and 31% improvement in the y-axis compared to the unmodified trial run. This proof of concept investigation leads to the possibility of further developing a feedfoward control system in vivo using catheters with omnidirectional deflection. Feedforward positional control allows for more flexibility in the design of an automated catheter system where problems such as systemic time delay may be a hindrance in instances requiring an immediate reaction.

Conceptual Design and Procedure for an Autonomous Intramyocardial Injection Catheter.

This article discusses existing catheter systems and proposes a conceptual design and procedure for an autonomous cell injection catheter for the purpose of transferring committed myogenic or undifferentiated stem cells into the infarct boundary zones of the left ventricle. Operation of existing catheters used for cell delivery is far from optimal. Commercial injection catheters available are handheld devices operated manually by means of tip deflection and torque capabilities. Interventionists require a hefty learning curve and often encounter difficulties in catheter stabilization and infarct detection, resulting in lengthy operation times and nonprecise injections. We examined current technologies and proposed a design incorporating robotic positional control, feedback signals, and an adaptable operational sequence to overcome these problems. The design provides the basis for robotic catheter construction that is able to autonomously assist the physician in transferring myogenic cells to the left ventricle infarct boundary zones.

Skeletal myoblast transplantation on gene expression profiles of insulin signaling pathway and mitochondrial biogenesis and function in skeletal muscle.

AIM: The study aims to investigate the gene expression profiling of insulin signaling pathway and mitochondrial biogenesis and function in the skeletal muscle of KK mice. METHODS: KK mice were divided into the following groups: KK control group, basal medium (M199) only; KK fibroblast group, with human fibroblast transplantation; KK myoblast group, with human skeletal myoblast transplantation. C57BL mice received hSkM transplantation as a normal control. Cells were transplanted into mice hind limb skeletal muscle. All animals were treated with cyclosporine for 6 weeks only. The mice were sacrificed in a fasting state at 12 weeks after treatment. Hind limb skeletal muscle was harvested and used for study of gene expression profiling. RESULTS: hSkMs survived extensively in mice skeletal muscle at 12 weeks after cell transplantation. Glucose tolerance test showed a significant decrease of blood glucose in the mice of KK myoblast group compared to the KK control and fibroblast groups. Transcriptional patterns of insulin signaling pathway showed alterations in KK myoblast as compared with KK control group (23 genes), KK fibroblast group (7 genes), and C57BL group (8 genes). Transcriptional patterns of mitochondrial biogenesis and function also had alterations in KK myoblast as compared with KK control group (27 genes), KK fibroblast group (9 genes), and C57BL group (6 genes). CONCLUSIONS: These data demonstrated for the first time that hSKM transplantation resulted in a change of gene transcript in multiple genes involved in insulin signaling pathway and mitochondrial biogenesis and function.

Liposome-based vascular endothelial growth factor-165 transfection with skeletal myoblast for treatment of ischaemic limb disease.

The study aims to use cholesterol (Chol) + DOTAP liposome (CD liposome) based human vascular endothelial growth factor-165 (VEGF(165)) gene transfer into skeletal myoblasts (SkMs) for treatment of acute hind limb ischaemia in a rabbit model. The feasibility and efficacy of CD liposome mediated gene transfer with rabbit SkMs were characterized using plasmid carrying enhanced green fluorescent protein (pEGFP) and assessed by flow cytometry. After optimization, SkMs were transfected with CD lipoplexes carrying plasmid-VEGF(165) (CD-pVEGF(165)) and transplanted into rabbit ischaemic limb. Animals were randomized to receive intramuscular injection of Medium199 (M199; group 1), non-transfected SkM (group 2) or CD-pVEGF(165) transfected SkM (group 3). Flow cytometry revealed that up to 16% rabbit SkMs were successfully transfected with pEGFP. Based on the optimized transfection condition, transfected rabbit SkM expressed VEGF(165) up to day 18 with peak at day 2. SkMs were observed in all cell-transplanted groups, as visualized with 6-diamidino-2-phenylindole and bromodeoxyuridine. Angiographic blood vessel score revealed increased collateral vessel development in group 3 (39.7 +/- 2.0) compared with group 2 (21.6 +/- 1.1%, P < 0.001) and group 1 (16.9 +/- 1.1%, P < 0.001). Immunostaining for CD31 showed significantly increased capillary density in group 3 (14.88 +/- 0.9) compared with group 2 (8.5 +/- 0.49, P < 0.001) and group 1 (5.69 +/- 0.3, P < 0.001). Improved blood flow (ml/min./g) was achieved in animal group 3 (0.173 +/- 0.04) as compared with animal group 2 (0.122 +/- 0.016; P= 0.047) and group 1 (0.062 +/- 0.012; P < 0.001). In conclusion, CD liposome mediated VEGF(165) gene transfer with SkMs effectively induced neovascularization in the ischaemic hind limb and may serve as a safe and new therapeutic modality for the repair of acute ischaemic limb disease.

Angiomyogenesis using liposome based vascular endothelial growth factor-165 transfection with skeletal myoblast for cardiac repair.

We aim to investigate the feasibility and efficacy of cholesterol (Chol)+DOTAP liposome (CD liposome) based human vascular endothelial growth factor-165 (hVEGF(165)) gene transfer into human skeletal myoblasts (hSkM) for cardiac repair. The feasibility and efficacy of CD liposome for gene transfer with hSkM was characterized using plasmid carrying enhanced green fluorescent protein (pEGFP). Based on the optimized transfection procedure, hSkM were transfected with CD lipoplexes carrying plasmid-hVEGF(165) (CD-phVEGF(165)). The genetically modified hSkM were transplanted into rat heart model of acute myocardial infarction. Flow cytometry revealed that about 7.99% hSkM could be transfected with pEGFP. Based on the optimized transfection condition, transfected hSkM expressed hVEGF(165) up to day-18 (1.7+/-0.1ng/ml) with peak at day-2 (13.1+/-0.52ng/ml) with >85% cell viability. Animal studies revealed that reduced apoptosis, improved angiogenesis with blood flow in group-3 animal's heart were achieved as compared to group-1 and 2. Ejection fraction was best recovered in group-3 animals. The study demonstrates that though gene transfection efficiency using CD liposome mediated hVEGF(165) gene transfer with hSkM was low; hVEGF(165) gene expression efficiency was sufficient to induce neovascularization, improve blood flow and injured heart function.

Nonviral vector-based gene transfection of primary human skeletal myoblasts.

Low-level transgene efficiency is one of the main obstacles in ex vivo nonviral vector-mediated gene transfer into primary human skeletal myoblasts (hSkMs). We optimized the cholesterol:N-[1-(2, 3-dioleoyloxy)propyl]-N, N, N-trimethylammonium methylsulfate liposome (CD liposome) and 22-kDa polyethylenimine (PEI22)- and 25-kDa polyethylenimine (PEI25)-mediated transfection of primary hSkMs for angiogenic gene delivery. We found that transfection efficiency and cell viability of three nonviral vectors were cell passage dependent: early cell passages of hSkMs had higher transfection efficiencies with poor cell viabilities, whereas later cell passages of hSkMs had lower transfection efficiencies with better cell viabilities. Trypsinization improved the transfection efficiency by 20% to 60% compared with adherent hSkMs. Optimum gene transfection efficiency was found with passage 6 trypsinized hSkMs: transfection efficiency with CD lipoplexes was 6.99 +/- 0.13%, PEI22 polyplexes was 18.58 +/- 1.57%, and PEI25 polyplexes was 13.32 +/- 0.88%. When pEGFP (a plasmid encoding the enhanced green fluorescent protein) was replaced with a vector containing human vascular endothelial growth factor 165 (phVEGF(165)), the optimized gene transfection conditions resulted in hVEGF(165) expression up to Day 18 with a peak level at Day 2 after transfection. This study demonstrated that therapeutic angiogenic gene transfer through CD or PEI is feasible and safe after optimization. It could be a potential strategy for treatment of ischemic disease for angiomyogenesis.

Myoblast-based cardiac repair: xenomyoblast versus allomyoblast transplantation.

OBJECTIVE: We sought to investigate immune cell kinetics in relation to skeletal myoblast survival and heart function improvement after nonautologous skeletal myoblast transplantation in a rat model of myocardial infarction. METHODS: One week after myocardial infarction, 208 Wistar rats were grouped into group 1 (n = 24, receiving 150 muL of medium only), group 2 (n = 24, receiving 150 muL of medium and cyclosporine [INN: ciclosporin]), group 3 (n = 40, human skeletal myoblast transplantation), group 4 (n = 40, human skeletal myoblast transplantation with cyclosporine treatment), group 5 (n = 40, rat skeletal myoblast transplantation), and group 6 (n = 40, rat skeletal myoblast transplantation with cyclosporine treatment). The hearts were harvested at 10 minutes and 1, 4, 7, and 28 days after cell transplantation. Skeletal myoblast survival was confirmed by means of immunohistochemical studies and quantified by using real-time polymerase chain reaction. Host immune responses were assessed by immunostaining for macrophages and CD4+ and CD8+ lymphocytes. Heart function was evaluated by means of echocardiographic analysis. RESULTS: The majority of macrophages and lymphocytes infiltrated in the acute phase (from day 1 to day 7) and then subsided by day 28. The donor skeletal myoblasts survived and differentiated well in all skeletal myoblast transplantation groups. Allogeneic skeletal myoblasts showed a superior survival rate than xenogeneic skeletal myoblasts (P < .01). Cyclosporine inhibited the infiltration of the immunocytes, enhanced skeletal myoblast survival, and improved heart performance compared with that seen in the groups not receiving cyclosporine treatment (P < .05). CONCLUSIONS: Allomyoblasts survive better than do xenomyoblasts after transplantation into infarcted myocardium. After inhibition of immunocyte infiltration by means of immunosuppressive treatment, skeletal myoblast survival is enhanced, with improved heart performance. These findings suggest the feasibility of nonautologous myoblast transplantation with immunosuppressive treatment.

Transplantation of nanoparticle transfected skeletal myoblasts overexpressing vascular endothelial growth factor-165 for cardiac repair.

BACKGROUND: We investigated the feasibility and efficacy of polyethylenimine (PEI) based human vascular endothelial growth factor-165 (hVEGF165) gene transfer into human skeletal myoblasts (HSM) for cell based delivery to the infarcted myocardium. METHODS AND RESULTS: Based on optimized transfection procedure using enhanced green fluorescent protein (pEGFP), HSM were transfected with plasmid-hVEGF165 (phVEGF165) carried by PEI (PEI-phVEGF165) nanoparticles. The transfected HSM were characterized for transfection and expression of hVEGF165 in vitro and transplanted into rat heart model of acute myocardial infarction (AMI): group-1=DMEM injection, group-2= HSM transplantation, group-3= PEI-phVEGF165-transfected HSM (PEI-phVEGF165 myoblast) transplantation. A total of 48 rats received cyclosporine injection from 3 days before and until 4 weeks after cell transplantation. Echocardiography was performed to assess the heart function. Animals were sacrificed for molecular and histological studies on the heart tissue at 4 weeks after treatment. Based on optimized transfection conditions, transfected HSM expressed hVEGF165 for 18 days with >90% cell viability in vitro. Apoptotic index was reduced in group-2 and group-3 as compared with group-1. Blood vessel density (x400) by immunostaining for PECAM-1 in group-3 was significantly higher (P=0.043 for both) as compared with group-1 and group-2 at 4 weeks. Regional blood flow (ml/min/g) in the left ventricular anterior wall was higher in group-3 (P=0.043 for both) as compared with group-1 and group-2. Improved ejection fraction was achieved in group-3 (58.44+/-4.92%) as compared with group-1 (P=0.004). CONCLUSION: PEI nanoparticle mediated hVEGF165 gene transfer into HSM is feasible and safe. It may serve as a novel and efficient alternative for angiomyogenesis in cardiac repair.

Improved angiogenic response in pig heart following ischaemic injury using human skeletal myoblast simultaneously expressing VEGF165 and angiopoietin-1.

OBJECTIVE: To achieve angiogenic interaction between VEGF(165) and angiopoietin-1 (Ang-1) using a novel adenoviral bicistronic vector (Ad-Bic) encoding the two factors and delivered ex vivo using sex-mismatched human skeletal myoblasts. METHODS AND RESULTS: A myocardial infarction model was developed in 29 female pigs; randomised into four groups: DMEM (group-1, n=6); Adenovirus null (Ad-null) vector-myoblast (group-2, n=5); Ad-Ang-1 myoblast (group 3, n=7) and Ad-Bic-myoblast (group-4, n=11). Three weeks later, 5 ml DMEM without myoblasts or containing 3 x 10(8) myoblasts carrying lac-z gene and transduced with Ad-null, Ad-Ang-1 or Ad-Bic were injected intra-myocardially in and around the infarct. 2D-echocardiography and fluorescent microsphere studies 6- and 12-weeks post-treatment revealed significantly improved cardiac performance and regional blood flow in groups 3 and 4. Histological studies and Y-chromosome analysis revealed extensive survival of lac-z positive myoblasts staining positive for human proteins in the pig heart. ELISA, immunostaining and RT-PCR revealed that Ad-Bic transduced myoblasts concomitantly but transiently expressed hVEGF(165) and Ang-1 both in vitro and in vivo. Double fluorescent immunostaining of the tissue sections for vWFactor-III and smooth muscle actin showed significantly higher vascular density of mature blood vessels per low power microscopic field in groups 3 and 4 at 6- and 12-weeks. CONCLUSION: Our combined approach led to enhanced angiogenesis with a greater percentage of functionally mature blood vessels in a porcine heart.

Reversal of myocardial injury using genetically modulated human skeletal myoblasts in a rodent cryoinjured heart model.

BACKGROUND: We hypothesized that combination therapy using human myoblasts and VEGF165 will lead to better prognosis in a failing heart. METHODS: Forty-eight female Wistar rats with cryoinjured hearts were randomized into non-treated normal (group-1, n=12), DMEM injected (group-2, n=10), myoblast-transplanted (group-3, n=12) and myoblast-hVEGF(165) (group-4, n=14). Ten days after cryoinjury, 200 microl DMEM containing 3x10(6) cells or without cells was injected into the injured myocardium. Animals were maintained on cyclosporine for 6 weeks post cell transplantation. Heart function was assessed by echocardiography. Animals were sacrificed and hearts were processed for histochemical and immunohistochemical studies. RESULTS: Histological examination showed survival of the donor myoblasts expressing lac-z and hVEGF165 in rat cardiac tissue. Fluorescent immunostaining for vWillebrand Factor-VIII and smooth muscle actin expression at low power microscope (x100) showed significantly higher blood vessel density in group-4 (31.25+/-1.82; 24.63+/-0.92) as compared to group-2 (13.29+/-1.0; p<0.001; 9.71+/-0.81, p<0.001) and group-3 (16.50+/-1.43, p<0.001; 14.5+/-1.34, p<0.001). Echocardiography showed that ejection fraction and fractional shortening of group-3 (93.36+/-1.52%, p=0.005; 75+/-3.75%, p=0.024) and group-4 (94.8+/-1.62%, p=0.003; 76.13+/-2.15%, p=0.011) significantly improved as compared to group-2 (81.8+/-3.3%, 55.1+/-7.18%). CONCLUSION: Myoblasts carrying of hVEGF165 are potential therapeutic transgene carriers for cardiac repair.

In vitro functional assessment of human skeletal myoblasts after transduction with adenoviral bicistronic vector carrying human VEGF165 and angiopoietin-1.

OBJECTIVES: We report in vitro functional assessment of human skeletal myoblasts with adenoviral bicistronic vector carrying human vascular endothelial growth factor-165 (hVEGF165) and angiopoietin-1 (Ang-1). METHODS: Myoblasts were assessed for their purity by desmin expression. A replication incompetent adenoviral bicistronic vector (Ad-Bic) carrying both hVEGF165 and Ang-1 was used for transduction of myoblasts. Transduction efficiency was assessed by dual fluorescent immunostaining of the transduced myoblasts. Expression efficiency was analyzed by enzyme linked immunosorbent assay (ELISA), Western blot and reverse transcription polymerase chain reaction (RT-PCR). The biological activity of the secreted human VEGF165 and Ang-1 was determined by human umbilical vein endothelial cells (HUVEC) proliferation assay, Thymidine [H3] incorporation assay and capillary-like structure formation. RESULTS: The myoblasts preparation was >98% pure. Fluorescent immunostaining showed >95% transduction efficiency. The transduced myoblasts secreted VEGF(165) for up to 30 days after transduction, with peak level (32 +/- 4 ng/ml) at day 8 after transduction as revealed by VEGF ELISA. Western blot further confirmed that both angiogenic factors were actively secreted by transduced myoblasts. The molecular weight was 42 kD for hVEGF165 and 70 kD for Ang-1 respectively. The expression of hVEGF165 and Ang-1 was significantly reduced at day-30 after transduction as seen by RT-PCR. The conditioned medium from bicistronic vector transduced myoblasts stimulated HUVEC to proliferate much faster than other conditioned media (>1.5 folds). Thymidine incorporation assay further confirmed this finding. Matrigel experiment suggested that HUVEC under the condition of both growth factors formed significantly more capillary-like structure. CONCLUSIONS: The bicistronic vector transduced myoblasts provides a novel strategy for therapeutic angiomyogenesis for cardiac repair.

Myoblast transplantation on the beating heart.

Cellular cardiomyoplasty using various types of donor cells is now validated by a large number of experimental studies. We report a case of cellular cardiomyoplasty performed on a beating heart using autologous skeletal myoblasts, thus combining the efficacy of both procedures. Approximately 2.5 g of rectus femoris muscle tissue biopsy was taken from the patient and cultured using a patented procedure to generate human myoblasts. The cell type and the purity of the cell culture were ascertained by immunostaining for human desmin expression. Under direct vision and stabilization with the Octopus III tissue stabilizer, 3.70 x 10(8) myoblasts in 3 ml of the patient's own serum were injected into the myocardium in 20 sites on the anterior wall and near the apex on the posterior wall, in and around the infarcted areas. In this case report, this procedure was found to be a safe and viable option, with improvement in cardiac function.

Human VEGF165-myoblasts produce concomitant angiogenesis/myogenesis in the regenerative heart.

Bioengineering the regenerative heart may provide a novel treatment for heart failure. On May 14, 2002, a 55-year-old man suffering from ischemic myocardial infarction received 25 injections carrying 465 million cGMP-produced pure myoblasts into his myocardium after coronary artery bypass grafting. As on August 28, 2002, his EKG was normal and showed no arrhythmia. His ejection fraction increased by 13%. He no longer experienced shortness of breath and angina as he did before the treatment. Three myogenesis mechanisms were elucidated with 17 human/porcine xenografts using cyclosporine as immunosuppressant. Some myoblasts developed to become cardiomyocytes. Others transferred their nuclei into host cardiomyocytes through natural cell fusion. As yet others formed skeletal myofibers with satellite cells. De novo production of contractile filaments augmented the heart contractility. Human myoblasts transduced with VEGF165 gene produced six times more capillaries in porcine myocardium than in placebo. Xenograft rejection was not observed for up to 20 weeks despite cyclosporine discontinuation at 6 weeks. Pros and cons of autografts vs. allografts are compared to guide future development of heart cell therapy.

Angiomyogenesis for cardiac repair using human myoblasts as carriers of human vascular endothelial growth factor.

This study investigated the potential of human skeletal myoblast carrying human VEGF(165) for angiomyogenesis for cardiac repair. A porcine heart model of chronic infarction was created in 18 female swine by coronary artery ligation. The animals were randomized into: group 1, DMEM injected ( n=6), group 2, myoblast transplanted ( n=5) and group 3, VEGF(165) myoblast transplanted ( n=7). Three weeks later 5 ml DMEM containing 3x10(8) myoblast carrying exogenous genes were injected into 20 sites in left ventricle intramyocardially in groups 2 and 3. Group 1 animals were injected 5 ml DMEM without cells. Animals were kept on 5 mg/kg cyclosporine per day for 6 weeks. Regional blood flow was measured using fluorescent microspheres. The heart was explanted between 6-12 weeks after transplantation for histological studies. Histological examination showed survival of lac-z expressing myoblasts in host tissue. Capillary density at low power field (x100) was 57.13+/-4.20 in group 3 which was significantly higher than the other groups. Regional blood flow was significantly improved 6 and 12 weeks after transplantation, which was 2.41+/-0.11 and 3.39+/-0.11 ml(-1) min(-1) g(-1), respectively, in group 3. Left ventricular ejection fraction increased from 31.25+/-4.09% to 43.0+/-2.68% at 6 weeks in group 3. Human myoblasts are potential transgene carriers for the myocardium, in addition to strengthening the weakened myocardium through myogenesis.

Human VEGF165-myoblasts produce concomitant angiogenesis/myogenesis in the regenerative heart.

Bioengineering the regenerative heart may provide a novel treatment for heart failure. On May 14, 2002, a 55-year-old man suffering from ischemic myocardial infarction received 25 injections carrying 465 million cGMP-produced pure myoblasts into his myocardium after coronary artery bypass grafting. As on August 28, 2002, his EKG was normal and showed no arrhythmia. His ejection fraction increased by 13%. He no longer experienced shortness of breath and angina as he did before the treatment. Three myogenesis mechanisms were elucidated with 17 human/porcine xenografts using cyclosporine as immunosuppressant. Some myoblasts developed to become cardiomyocytes. Others transferred their nuclei into host cardiomyocytes through natural cell fusion. As yet others formed skeletal myofibers with satellite cells. De novo production of contractile filaments augmented the heart contractility. Human myoblasts transduced with VEGF165 gene produced six times more capillaries in porcine myocardium than in placebo. Xenograft rejection was not observed for up to 20 weeks despite cyclosporine discontinuation at 6 weeks. Pros and cons of autografts vs. allografts are compared to guide future development of heart cell therapy. (Mol Cell Biochem 263: 173-178, 2004).

High efficiency transduction of human VEGF165 into human skeletal myoblasts: in vitro studies.

We report the transduction of human VEGF165 gene into human myoblast and characterization of the transduced myoblasts for transduction and expression efficiency. Human myoblasts were assessed by immunostaining for desmin expression. A replication incompetent adenoviral vector carrying human VEGF165 was constructed and used for transduction of myoblasts. Immunostaining of transduced myoblasts was used to determine transduction efficiency. Expression efficiency was confirmed by immunoblotting, ELISA and reverse transcription (RT)-PCR analysis using human VEGF165 specific primers (5'-3' = 5'ATGAACTTTCTGCTGTCTTGGGTG and 3'-5' = ACACCGCCTCGGCTTGTCACA3'. Biological activity of the secreted VEGF165 was determined by human umbilical vein endothelial cell proliferation and [H3] thymidine incorporation assays. Human myoblast preparation was >95% pure with 99% viability after transduction. Immunostaining showed >95% VEGF(165) positive myoblasts. Western blotting and ELISA revealed high VEGF165 expression in the transduced myoblasts. Maximum transduction efficiency was achieved by 8 h exposure of myoblasts to virus at 1:1,000 ratio on three consecutive days. Concentration of VEGF165 released in the culture medium peaked (37 +/- 3 ng/ml) at 8 days post-transduction. Cell proliferation assay on human umbilical vein endothelial cells using supernatant from VEGF165 transduced myoblasts revealed extensive proliferation of cells which was suppressed in the presence of anti-human VEGF165 antibody in culture medium and was further confirmed by thymidine incorporation assay. The untransduced myoblasts secreted VEGF165 in vitro (300 +/- 50 pg/ml) that is enhanced many folds (37 +/- 3 ng/ml) in VEGF165 transduced myoblast as determined by ELISA. These studies suggest that human myoblast are potential carriers of human VEGF165 to achieve concurrent angiomyogenesis for cardiac repair.